SequoraDNA
FASTA Filter Tool

FASTA Filter Tool
Sequora

FASTA Filtering Tool

(Under Construction)

This tool makes it easy to filter for sequences containing specific strings from a multi-sequence FASTA file. Here’s how it works:

  1. File Upload: You start by uploading your FASTA file containing multiple sequences.

  2. Search Input: Next, you enter a search term (for example, a gene or motif) into the provided text box. (e.g. TAAAATCTAGTCACTAATAACAACACTTTTTCTAGCAAAGCGTAGATGATTTTCTAATCTTTGGCTAGAG)

  3. Filtering Process: When you click the "Filter Sequences" button, the tool reads your file and splits it into individual sequence records. It then scans each record to see if it contains your search term (ignoring case differences).

  4. Download Results: If any sequences match your search, they are compiled into a new FASTA file. A download link then appears, allowing you to save this filtered file for further analysis.

This streamlined process helps you quickly isolate sequences containing subsequences of interest, integrating smoothly into your Bioinformatics project!